AT5G08185.1
|
Subcellular Consensus
(Prediction and Experimental) min: :max.
SUBAcon:extracellular 0.987 What is SUBAcon? |
|
||||||||||||||||
| Experimental Localisations and PPI |
|
||||||||||||||||
|
SUBAcon links
AGI-AGI relationships |
|
||||||||||||||||
| Description (TAIR10) | protein_coding : microRNA162A | ||||||||||||||||
| Curator Summary (TAIR10) |
Encodes a microRNA that targets DCL1. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCGAUAAACCUCUGCAUCCAG | ||||||||||||||||
| Computational Description (TAIR10) |
microRNA162A (MIR162A); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: RNA interference; LOCATED IN: endomembrane system; EXPRESSED IN: stem, root, inflorescence, cultured cell, leaf; Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). | ||||||||||||||||
| Protein Annotations |
|
||||||||||||||||
| Coordinates (TAIR10) | chr5:-:2634820..2635215 | ||||||||||||||||
| Molecular Weight (calculated) | 5408.65 Da | ||||||||||||||||
| IEP (calculated) | 8.24 | ||||||||||||||||
| GRAVY (calculated) | -0.01 | ||||||||||||||||
| Length | 45 amino acids | ||||||||||||||||
| Sequence (TAIR10) (BLAST) |
1: MHVCNLGYMF LSIWFHKAIK IQLFTTCEEK SEGKQSQVRL LFWES | ||||||||||||||||
| See Also |
|
||||||||||||||||
Citation
If you find this resource useful please cite one of the following publications:
Hooper CM, Castleden I, Tanz SK, Aryamanesh, and Millar, AH (2017) SUBA4: the interactive data analysis centre for Arabidopsis subcellular protein locations Nucleic Acids Res. Jan 4;45(D1):D1064-D1074. doi: 10.1093/nar/gkw1041 (PubMed)
Hooper CM, Tanz SK, Castleden IR, Vacher MA, Small ID, Millar AH (2014) "SUBAcon: a consensus algorithm for unifying the subcellular localization data of the Arabidopsis proteome. Bioinformatics." 1;30(23):3356-64. (Bioinformatics) (PubMed)
:max